jajanewman05 jajanewman05

12-02-2020
History

contestada

What was are first President

Respuesta :

jenniejungkook9 jenniejungkook9

12-02-2020

Answer:

George Washington was the first President

Explanation:

Answer Link

operativeknife operativeknife

12-02-2020

George Washington was the first US president

Answer Link

Otras preguntas

Match each of the options above to the items below. 1. Large scale disinfection of drinking water 2. Disinfection in dairies, food processing plants, restauran

Some money orders have serial numbers that consist of a 10-digit number followed by a check digit. The check digit is chosen to be the sum of the first 10 digit

Please could someone help me ?

What mountains form the alpine mountain system

A company's perpetual preferred stock currently trades at $87.50 per share, and it pays an $8.00 annual dividend. IF the company were to sell a new preferred is

(a) In the deep space between galaxies, the density of atoms is as low as 106 atoms/m^3 , and the temperature is a frigid 2.7 K. What is the pressure? (b) What

Andrea has been diagnosed with schizophrenia. She has a persistent delusion that she is the Virgin Mary. What is the best description of her delusion? a. It is

I'm a mom trying to help my son with improper fractions. Can u help ?

What is the volume of 0.05 mol of neon gas at STP?

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade