chinochica1234ox6429 chinochica1234ox6429

10-02-2021
Mathematics

contestada

There are 300 audience members at an opera and 26 are wearing bowties. a) How many audience members are not wearing bowties? What is the universal set for this scenario?

Respuesta :

marianvillanueva270 marianvillanueva270

10-02-2021

Answer:

300-26=274

The opera

Step-by-step explanation:

hope helps

Answer Link

Otras preguntas

ex 3 page 42 podręcznik angielski repretytorum usmo klasisty

1) When Augustus is referring to his “father” who is he most likely referring to? 2) What was Augustus's goal for writing this document and who is the intended

A local manufacturing firm produces four different metal products, each of which must be machined, polished and assembled. The specific time requirements (in ho

4. How do ocean currents affect the temperature?

Talhah and Rosina are doing push ups for PE class. They both want to complete the same number of push ups, but Talhah wants to do 6 push ups per set and Rosina

Ayudaaa es urgente, pagina 44 de matemáticas segundo grado edición edelvives toda la pagina

A 20 cm nail ,just fit inside cylindrical can.Three identical spherical balls need to fit entirely within the can.What is the maximum radius os each ball?

Black Holes A black hole is a region of space-time from which nothing can escape, even light. This may sound strange, but it is possible. To see why this happe

Since the child is only 9 years old, the parents give him the snack even if he only feeds the dog until he learns that he must walk him also. This is a good exa

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated